Trying to implement Boyer Moore, bad character matching algorithm without looking at the answers. I want to exit this loop I wrote with just one line of "No match" if there was no pattern found, here is my code:
T = 'ATGGGTATGGCTCGGCTCGG'
p = 'ATCG'
skip = 0
while skip + len(p) < len(T):
string = T[skip:skip+len(p)]
if string == p:
print "offset at: ", skip
break
for i in range(len(string), 0, -1):
if (string[i-1] != p[i-1]):
if string[i-1] in p[:i-1]:
skip += (i - p.find(string[i-1]) - 1)
break
elif not string[i-1] in p[:i-1]:
skip += i
break
Any hits regarding how to modify the code.
Thank you,
xp
edit: Scheme gave me the answer, as easy as that. I was so looping my head in the line string == p or string != p. Thank you for all your comments.
If i am understanding you correctly you would like to exit your while loop and print "no match" only once, if the string p is not contained in t. This looks like the all too common DNA exercise.
Anyway a simple way to do what you want is to check for the substring p in t and break if it is not found. The answer here: How to determine whether a substring is in a different string would help with that.
Basically:
T = 'ATGGGTATGGCTCGGCTCGG'
p = 'ATCG'
skip = 0
while skip + len(p) < len(T):
if not p in T:
print "no match"
break
string = T[skip:skip+len(p)]
if string == p:
print "offset at: ", skip
break
for i in range(len(string), 0, -1):
if (string[i-1] != p[i-1]):
if string[i-1] in p[:i-1]:
skip += (i - p.find(string[i-1]) - 1)
break
elif not string[i-1] in p[:i-1]:
skip += i
break
The key here is the line if not p in T: Which is basically saying If the string p does not exist inside the string T then do something. else, carry on.
On top of this you may want to consider looking at some good practices like variable naming, and using functions.
